KA4b
Primer features | |||||
Name | Sequence | Length | Tm | ||
KA4b.F | AAAGGTCTCTCTCACTGTCT | 20 nt | 56.4 °C | ||
KA4b.R | CCTCAGCCCAACTCAAAGCC | 20 nt | 62.5 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 137-141 | ||||
Number of alleles detected | 3 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-1 Fiesta-1 Fiesta x Totem-1 Malling9-1 Apple Integrated Map-1 M.27 x M.116-1 | ||||
Reference publication | Yamamoto, T; Kimura, T; Sawamura, Y; Manabe, T; Kotobuki, K; Hayashi, T; Ban, Y; Matsuta, N (2002) Simple sequence repeats for genetic analysis in pear. Euphytica 124(1): 129?137 | ||||
Remarks | clean, compl. band(s) | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
141:137 139:141 137 141 137 141 141 137:141 |
Send comments to Luca Gianfranceschi