CH02d10b
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02d10b.F | GTAACCTTTGTTGCGCGTG | 19 nt | 57.3 °C | ||
CH02d10b.R | GCCTTGAGTTTCTCAGCATTG | 21 nt | 59.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 152-168 | ||||
Number of alleles detected | 3 | ||||
Expected heterozygosity | 0.61 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 175 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-15 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02d10b aattacccgactttaggatcatgtcgattttgtaacctttgttgcgcgtgccctctttggtagcctgtgaatatctctct ctctctctctctctctctctctctctctctctctctctctcccagtaaccagatgttctgccacgatttacatatcaaag atctaatactattttacttagtgaacaatgctgagaaactcaaggcatgtttgcatgctacaatattgcaagtaatgggt tatgtttccttgataaatcatacctttgggggtattgtttatcattctcttgtttcaagtaaacatgttctcagcttgtt atcaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
152:156 152:156 152:156 156 156:168 152:156 152:168 |
Send comments to Luca Gianfranceschi