CH05e04
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05e04.F | AAGGAGAAGACCGTGTGAAATC | 22 nt | 60.3 °C | ||
CH05e04.R | CATGGATAAGGCATAGTCAGGA | 22 nt | 60.3 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | presumed multi-locus | ||||
Detected loci | |||||
Alleles size range | 153-234 | ||||
Number of alleles detected | 9 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 164 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-16 Discovery-16 Fiesta-16 Fiesta x Totem-16 Apple Integrated Map-16 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05e04 aatttcccaaggnaaacaatccgtctgacttgatatttagatgactgtaacatggacaagtggatatgacatcgtggaag caaccccttttgttgagtggggtataaaaggagaagaccgtgtgaaatccccagctgggacattgaacttcgaccgcaac accatgtgtggtgtgtttgctctctctctctctctctctctctctctctctctctctctctcttgggggggatggttgag ggttgcatctcctgactatgccttatccatgttacgttctacaaacacaggttgcacccggcaaaaccgtggggttggcg aagatcctggatttatacacactgctttctgaaagaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
159:230:234 153:167:230 153:161:230 159:175 167 157:167 167 |
Send comments to Luca Gianfranceschi