C894
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| C894.F | GGCTGGTTTTAGAGCGACAC | 20 nt | 60.5 °C |  |
|
| C894.R | ATCCCATGACTCACCAGCTC | 20 nt | 60.5 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 280-400 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 193 | ||||
| Linkage group(s) | |||||
| Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
| Other maps | PI 613988-10 Royal Gala-10 | ||||
| Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
| Remarks | EST accessions in GenBank: EB151006, EB151674, CV628341, CN578813, CO756583, CO576645, EB145475, CO900439, CV085003, DR991154, CV082539, EB123404, DR991886, EB157465, EB122403, EB110951, DR992756, CO865810, CN445029, DT002177, CO051674, CV629036, CO868452 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
