CH-Vf1
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH-Vf1.F | ATCACCACCAGCAGCAAAG | 19 nt | 57.3 °C | ![]() |
|
CH-Vf1.R | CATACAAATCAAAGCACAACCC | 22 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 129-174 | ||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | |||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | ETH-Zurich DCA-Bologna | ||||
Other maps | Discovery-1 Discovery x TN10-8-1 Discovery-1 Fiesta x Totem-1 PI 613988-1 Malling9-1 Robusta5-1 Apple Integrated Map-1 M.27 x M.116-1 | ||||
Reference publication | Vinatzer B.A.,Patocchi A., Tartarini S., Gianfranceschi L., Sansavini S., Gessler C. (2004) Isolation of two microsatellite markers from BAC clones of the Vf scab resistance. Plant Breeding 123(4): 321-326 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Not available |

