CH02e02
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02e02.F | CTCATCAGTCTCACTGACTGTGTG | 24 nt | 65.2 °C | ![]() |
|
CH02e02.R | AGGGTCAGGGTCAGTCAGG | 19 nt | 61.6 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 122-130 | ||||
Number of alleles detected | 2 | ||||
Expected heterozygosity | 0.44 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 122 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-13 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02e02 aattggaagcaaaagagagagagagagagagagagagagagagcgcgcgctagtgaaagctangtaggaagagcaaggag tgtgtttgcaggcgagaaaactagaaacagcaaaaatagcaaatagtgttcagaaacctacacggcctctcacctcatca gtctcactgactgtgtgggggtggtgggaaagaggagagaggagagagagagagagagagagagcgagggagaagtgctt ttaagtagttaacaaccctgactgaccctgaccctaaaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
122:130 122 122 122 122 122:130 122:130 |

