CH03b01
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03b01.F | ACAAGGTAACGTACAACTCTCTC | 23 nt | 61.1 °C | ![]() |
|
CH03b01.R | GTCACAAAACCGCCAGATG | 19 nt | 57.3 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | presumed multi-locus | ||||
Detected loci | |||||
Alleles size range | 160-180 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 176 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-2 M.27 x M.116-2 M.27 x M.116-15 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03b01 aattcgaacaaggtaacgtacaactctctctctctctctctcnctctctctctctctctctatttctctgtcattcgatc ttcgattaccgttgcaattgatgtgtaatggatctnggtangatccnaattgcaggcgtactttttcnganatggcgggc ggcgcatctggcggttttgtgacaaaancattcgantctaagctcaangagtgcgctccgaanancatgcatatcttcag aangctattcgcgcttatttacgtttcnttctgattcccttgtgaatacacttatgcataaacattgcgtnttcgcatgt attttttggactntggannatcangtgtttactttggttgngagattgttgaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
160:166:178 162:166:178 162:166:178 162:166:178 160:172:180 160:180 180 |

