CH03g12
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03g12.F | GCGCTGAAAAAGGTCAGTTT | 20 nt | 56.4 °C | ![]() |
|
CH03g12.R | CAAGGATGCGCATGTATTTG | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 154-200 | ||||
Number of alleles detected | 10 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 168 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-1 Fiesta x Discovery-3 Telamon-3 Telamon-12 Discovery-1 Discovery-3 Fiesta-1 Fiesta-3 Fiesta x Totem-1 Fiesta x Totem-3 Robusta5-1 Malling9-3 Robusta5-3 Apple Integrated Map-1 Apple Integrated Map-3 M.27 x M.116-1 M.27 x M.116-3 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03g12 aattgctggcaaccatgaaggacatcgacttcagcgctgaaaaaggtcagttttcgtctctctctctctctctctctctc tctctctctctcctccgtcaatactcgatttaatatttgttatttttgacagagcttgccaaggattttctttccaactt tcccgattcgaatggcgaacccaaatacatgcgcatccttgtgagtatccctcttcttctttaccacattttcttgtaag ctttgatagtactgtctgaaaaccctaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
162:170:184:184 154:162:182:200 154:158:182:196 154:182:200 170:168:200 158:170:196:200 154:158:184:200 |

