CH03g12
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH03g12.F | GCGCTGAAAAAGGTCAGTTT | 20 nt | 56.4 °C |  |
|
| CH03g12.R | CAAGGATGCGCATGTATTTG | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 154-200 | ||||
| Number of alleles detected | 10 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 168 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-1 Fiesta x Discovery-3 Telamon-3 Telamon-12 Discovery-1 Discovery-3 Fiesta-1 Fiesta-3 Fiesta x Totem-1 Fiesta x Totem-3 Robusta5-1 Malling9-3 Robusta5-3 Apple Integrated Map-1 Apple Integrated Map-3 M.27 x M.116-1 M.27 x M.116-3 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH03g12 aattgctggcaaccatgaaggacatcgacttcagcgctgaaaaaggtcagttttcgtctctctctctctctctctctctc tctctctctctcctccgtcaatactcgatttaatatttgttatttttgacagagcttgccaaggattttctttccaactt tcccgattcgaatggcgaacccaaatacatgcgcatccttgtgagtatccctcttcttctttaccacattttcttgtaag ctttgatagtactgtctgaaaaccctaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
162:170:184:184 154:162:182:200 154:158:182:196 154:182:200 170:168:200 158:170:196:200 154:158:184:200 |
||||
Send comments to Luca Gianfranceschi
