CH05d08
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05d08.F | TCATGGATGGGAAAAAGAGG | 20 nt | 56.4 °C | ![]() |
|
CH05d08.R | TGATTGCCACATGTCAGTGTT | 21 nt | 57.4 °C | ||
SSR info | |||||
SSR repeat type | Compound | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 91-143 | ||||
Number of alleles detected | 10 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 145 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta-17 Discovery x TN10-8-17 Discovery-9 Discovery-17 Fiesta-17 Fiesta x Totem-17 TN10-8-17 Royal Gala-17 Apple Integrated Map-17 M.27 x M.116-17 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05d08 aattagtttcatggatgggaaaaagaggtggagagagagagagagagagagagagagagagagagagagagagagagaga gcatatatcaggagaggttatcactttagtcagctaactgtaacctaatcacaacactgacatgtggcaatcagtataat aaaaactctcaaaataaaagcttcaaaaaagttatcctcaagcttagtgagttatgaaagaatcagcattgtaaaatcca tgatatacacttcttcaacactggtattccagagttaagaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
110:122 106:110:122:124 91:110:120:122 106:122:125:135 110:122:143 110:122:137 122:143 |

