HGA8b
Primer features | |||||
Name | Sequence | Length | Tm | ||
HGA8b.F | AACAAGCAAAGGCAGAACAA | 20 nt | 54.3 °C | ![]() |
|
HGA8b.R | CATAGAGAAAGCAAAGCAAA | 20 nt | 52.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 133-164 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-3 Fiesta-3 Fiesta-11 Fiesta x Totem-3 Fiesta x Totem-11 M.27 x M.116-3 M.27 x M.116-11 | ||||
Reference publication | Yamamoto, T; Kimura, T; Sawamura, Y; Manabe, T; Kotobuki, K; Hayashi, T; Ban, Y; Matsuta, N (2002) Simple sequence repeats for genetic analysis in pear. Euphytica 124(1): 129?137 | ||||
Remarks | dirty | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
135:151:160:164 135:151:156:160:164 151:156:160:164 156:160:164 133:156:160 151:156:160:164 135:156:160:164 151:156:160:164 |

