Hi04d10
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| Hi04d10.F | AAATTCCCACTCCTCCCTGT | 20 nt | 58.4 °C |  |
|
| Hi04d10.R | GTTTGAGACGGATTGGGGTAG | 21 nt | 61.3 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 164-182 | ||||
| Number of alleles detected | 4 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | HiDRAS consortium | ||||
| Other maps | Fiesta-6 PI 613988-6 | ||||
| Reference publication | Silfverberg-Dilworth E, Matasci C L, Van de Weg W E, Van Kaauwen M P W,Walser M, Kodde L P, Soglio V, Gianfranceschi L, Durel C E, Costa F, Yamamoto T, Koller B, Gessler C, Patocchi A (2006) Microsatellite markers spanning the apple (Malus x domestica Borkh) genome. Tree Genetics & Genomes 2(4): 202-224 | ||||
| Remarks | extra bands | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
164 nul 182 164:182 180 164 182 164:180 |
||||
Send comments to Luca Gianfranceschi
