MDAJ761-SSR
Primer features | |||||
Name | Sequence | Length | Tm | ||
MDAJ761-SSR.F | CCCTAAACACACAGCCTCCT | 20 nt | 60.5 °C | ||
MDAJ761-SSR.R | GTTTCAGCATCGCAGAGAACTGAG | 24 nt | 65.2 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 210-208 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-14 M.27 x M.116-14 | ||||
Reference publication | Silfverberg-Dilworth E, Matasci C L, Van de Weg W E, Van Kaauwen M P W,Walser M, Kodde L P, Soglio V, Gianfranceschi L, Durel C E, Costa F, Yamamoto T, Koller B, Gessler C, Patocchi A (2006) Microsatellite markers spanning the apple (Malus x domestica Borkh) genome. Tree Genetics & Genomes 2(4): 202-224 | ||||
Remarks | clean | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
LucaG (luca.gianfranceschi@unimi.it) Date 13 February 2006 - Time: 14:53 Same sequence and marker as AJ000761 Sequence Assembly Library View Sequence Info at PlantGDB | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
248 210:248 226:244 244:248 210:252 246:248 210:250 244:248 |
Send comments to Luca Gianfranceschi