NZ01a6
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ01a6.F | AGGATTGCTGGAAAAGGAGG | 20 nt | 58.4 °C | ![]() |
|
NZ01a6.R | TTAGACGACGCTACTTGTCCT | 21 nt | 59.4 °C | ||
SSR info | |||||
SSR repeat type | |||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 120-138 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.75 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 136 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Braeburn-16 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
130:138 128:130 132:134 124:138 130 130:136 120:136 |

