NZ04h11
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ04h11.F | CTTCCATCGAGATTGCATCATA | 22 nt | 58.4 °C | ||
NZ04h11.R | CGAATTGAGAGGTCGTCGTT | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 201-225 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.65 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 225 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Fiesta-9 Prima-9 Fiesta x Totem-9 Apple Integrated Map-9 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
226 226:208 226:208 202:208 202:226 202:226 n.d. |
Send comments to Luca Gianfranceschi