Select a marker

NZmsEB145764
Primer features
Name Sequence Length Tm  
NZmsEB145764.F TTCCAGCGATCCAAAACAAT 20 nt 54.3 °C Primer Stats
NZmsEB145764.R GCTCAGGAACACCTCGTTCT 20 nt 60.5 °C
SSR info
SSR repeat type
Locus type
Detected loci
Alleles size range
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp Td 6560
Sequenced allele size 198
Linkage group(s)
Developed by
Other maps Robusta5-17 TN10-8-17 Robusta5-17
Reference publication (2008) Genome mapping of three major resistance genes to woolly apple aphid (Eriosoma lanigerum Hausm.). Tree Genetics & Genomes 4(): 233236
Remarks
Sequence
>gi|91035346|gb|EB145764.1|EB145764 021016ABCA003488HT (ABCA) Royal Gala fruit stored at 0.5 degrees C for 24 hours Malus x domestica cDNA clone ABCA003488, mRNA sequence TATTTTTTGCTCTCGCATCTTCCAGCGATCCAAAACAATAATCAGGAGTTTCGCGGGGGAATCTTGGGAA AGACTTGTTTTCTTTAGACTGAAACGATCAGGAGTTTCACTTCTTTACTTGAAATCAATGAATACCAGCA GCGCCGCCCATGGAACCGCCGCCGCCGGTTCGTCATCCTCTCGGCGTTCAAGCTGGAAGAACGAGGTGTT CCTGAGCTTTAGAGGCGAGGACACACGCAATGGGTTCACAAACCACCTCTCCTATGCGTTACGCGAGGCC GGAATCAACACGTTTACAGACGACGAGCTCAGAAGGGGGGAAAATATACAGAGCGAACTTGACCGAGAAA TCGAAGGGTCGAGGATCGCGGTCGTCGTCTTCTCAAAGAGTTACGCGGAGTCCCGATGGTGCTTGAGGGA GCTGTCGAAGATCAGGAGAGAGGGGAAAGTAGTCTATCCTATATTCTACGACATTGACCCTTCTCAATTG AGGGAACAGAGTGGTGGTTTGGGGGAAGCATTTCAGAATGAAGATCCAAATGAGGTGGAGCAGTGGAGAA GGGATCTTAAGGCTTGTGCGGATTTGAGTGGCCCGACTTTTAAGACCACGGCGGGCGGGTATAAATTCAA ACTTCCTCTTTTACAAAATTTAATTGCTTGCAACATCATCAGCCAAAATCATGATGAATAAGGCATTTAG
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi