UDP96-019
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| UDP96-019.F | TTGGTCATGAGCTAAGAAAACA | 22 nt | 56.5 °C |  |
|
| UDP96-019.R | TAGTGGCACAGAGCAACACC | 20 nt | 60.5 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | |||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | 0.26 | ||||
| PCR annealing temp | 57 | ||||
| Sequenced allele size | 216 | ||||
| Linkage group(s) | |||||
| Developed by | Dipartimento di Produzione vegetale e tecnologie agrarie, University of Udine, Udine, Italy | ||||
| Other maps | Fiesta x Totem-1 | ||||
| Reference publication | Cipriani G., Lot G., Huang W.-G., Marrazzo M. T., Peterlunger E., Testolin R. (1999) AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L) Batsch]: isolation, characterisation and cross-species amplification in Prunus. Theoretical and Applied Genetics 99(1-2): 65-72 | ||||
| Remarks | SSR marker developed in pear | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
