UDP98-416
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| UDP98-416.F | TTTTCTCAGCAGCCAAACAA | 20 nt | 54.3 °C |  |
|
| UDP98-416.R | ATGTTTCGTGCTTCTGCTCC | 20 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | |||||
| Detected loci | |||||
| Alleles size range | 96-114 | ||||
| Number of alleles detected | 4 | ||||
| Expected heterozygosity | 0.17 | ||||
| PCR annealing temp | 57 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | Dipartimento di Produzione vegetale e tecnologie agrarie, University of Udine, Udine, Italy | ||||
| Other maps | Fiesta x Totem-11 M.27 x M.116-11 | ||||
| Reference publication | Testolin, R; Marrazzo, T; Cipriani, G; Quarta, R; Verde, I; Te Dettori, M; Pancaldi, M; Sansavini, S (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3): 512-520 | ||||
| Remarks | SSR marker developed in peach | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
