CH-Vf1
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH-Vf1.F | ATCACCACCAGCAGCAAAG | 19 nt | 57.3 °C |  |
|
| CH-Vf1.R | CATACAAATCAAAGCACAACCC | 22 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 129-174 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | ETH-Zurich DCA-Bologna | ||||
| Other maps | Discovery-1 Discovery x TN10-8-1 Discovery-1 Fiesta x Totem-1 PI 613988-1 Malling9-1 Robusta5-1 Apple Integrated Map-1 M.27 x M.116-1 | ||||
| Reference publication | Vinatzer B.A.,Patocchi A., Tartarini S., Gianfranceschi L., Sansavini S., Gessler C. (2004) Isolation of two microsatellite markers from BAC clones of the Vf scab resistance. Plant Breeding 123(4): 321-326 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
