UDP96-019
Primer features | |||||
Name | Sequence | Length | Tm | ||
UDP96-019.F | TTGGTCATGAGCTAAGAAAACA | 22 nt | 56.5 °C | ![]() |
|
UDP96-019.R | TAGTGGCACAGAGCAACACC | 20 nt | 60.5 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | |||||
Detected loci | |||||
Alleles size range | |||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | 0.26 | ||||
PCR annealing temp | 57 | ||||
Sequenced allele size | 216 | ||||
Linkage group(s) | |||||
Developed by | Dipartimento di Produzione vegetale e tecnologie agrarie, University of Udine, Udine, Italy | ||||
Other maps | Fiesta x Totem-1 | ||||
Reference publication | Cipriani G., Lot G., Huang W.-G., Marrazzo M. T., Peterlunger E., Testolin R. (1999) AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L) Batsch]: isolation, characterisation and cross-species amplification in Prunus. Theoretical and Applied Genetics 99(1-2): 65-72 | ||||
Remarks | SSR marker developed in pear | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)