CH04g09
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH04g09.F | TTGTCGCACAAGCCAGTTTA | 20 nt | 56.4 °C | ![]() |
|
CH04g09.R | GAAGACTCATGGGTGCCATT | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 141-177 | ||||
Number of alleles detected | 11 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 157 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-5 Discovery-10 Fiesta x Totem-10 Fiesta x Totem-15 Malling9-5 Robusta5-5 Apple Integrated Map-5 Apple Integrated Map-10 M.27 x M.116-5 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH04g09 aattgtagctttgatgccaacagtggcctataaagtccattgtcgcacaagccagtttattagttcaagaccagtgttct gctctctctctctctctctctctctctctctctctctctctccgtgtgtttatcttcatctctctcacagtcacacactc ggagagtgctagctgcaatggcacccatgagtcttcctcctggatttagattccacccaacagatgaagagcttgttgct tactatctggatcgaaaaatcaatggtcggaccattgagctagaaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
151:153:169 147:151:151 143:149:177 153:157 141:145:155 145:149 145:155 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)