GD100
Primer features | |||||
Name | Sequence | Length | Tm | ||
GD100.F | ACAGCAAGGTGTTGGGTAAGAAGGT | 25 nt | 65.8 °C | ![]() |
|
GD100.R | TGCGGACAAAGGAAAAAAAAAAGTG | 25 nt | 60.9 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | unknown | ||||
Detected loci | |||||
Alleles size range | 223-242 | ||||
Number of alleles detected | 14 | ||||
Expected heterozygosity | 0.879 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 227 | ||||
Linkage group(s) | |||||
Developed by | USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA | ||||
Other maps | Braeburn-15 Telamon-15 Mondial Gala-10 Fiesta x Totem-10 Malling9-10 Robusta5-10 | ||||
Reference publication | Hokanson S. C., Szewc-McFadden A. K., Lamboy W.F., J. R. McFerson J.R. (1998) Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus?domestica borkh. core subset collection. Theoretical and Applied Genetics 97(5-6): 671-683 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)