CH05g02
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05g02.F | AGTGCAGCTTTCAGCTCAGATT | 22 nt | 60.3 °C | ![]() |
|
CH05g02.R | AGTCAGACACACCAAAATCCCT | 22 nt | 60.3 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 135-145 | ||||
Number of alleles detected | 5 | ||||
Expected heterozygosity | 0.66 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 141 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-12 M.27 x M.116-12 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05g02 aattttccacaaagctcaatcagtgcagctttcagctcagatttgtgattctctctctctctctctctctctctctctct ctctccccctctccttctccctctctctgcatacaaacaggtgtagcagcagcagcagagagggattttggtgtgtctga ctcctctggctatggagagttcccattcccaagatgaccgtgagccagcccctccgggcgtcgactcctttccacaatat tccaactcaacccatcactttacttcccactgccagactttcaccccacacccacaccaacagccgcagggttgcgtttt tgggctcaagattctactgcaaactccgcgtttggatatccgaaaacgctagccaaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
135:145 145 141:145 135:145 143:145 135:143 135:145 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)