CH01e12
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01e12.F | AAACTGAAGCCATGAGGGC | 19 nt | 57.3 °C | ||
CH01e12.R | TTCCAATTCACATGAGGCTG | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 246-278 | ||||
Number of alleles detected | 5 | ||||
Expected heterozygosity | 0.67 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 276 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-8 Prima-8 Braeburn-11 Telamon-11 Fiesta x Totem-8 Fiesta x Totem-15 Apple Integrated Map-8 M.27 x M.116-8 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01e12 gctcattcgacacgtggactaaaactgaagccatgagggcatgcacgcacggtatataatcaagacattcttatcttcct cctcttaaaccagacacattcctctctctctctctctctctctctctctctctctctctctctctctctctctctctctc tgtgcaagattgtgagtgagaagcggagagatcgatgatggggaaaaggaggagtatattgctcttgttagtaatgggat tgtttgtttttagtgttggagcagcagatcatcagcctcatgtgaattggaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
246:250 250 250 262:278 250:278 250:278 250 |
Send comments to Luca Gianfranceschi