CH05b06
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH05b06.F | ACAAGCAAACCTAATACCACCG | 22 nt | 60.3 °C |  |
|
| CH05b06.R | GAGACTGGAAGAGTTGCAGAGG | 22 nt | 64.0 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 138-226 | ||||
| Number of alleles detected | 14 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 170 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-10 Discovery x TN10-8-5 Discovery-5 Fiesta-5 Fiesta-16 Fiesta x Totem-10 Fiesta x Totem-16 Apple Integrated Map-5 Apple Integrated Map-10 M.27 x M.116-3 M.27 x M.116-10 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH05b06 aattccttatgcacggtacatccatctcccccagttgtctccccccctctctcccctcatcagaacccagaaaaaacaag caaacctaataccaccgccaaacacacacccaacacaccctgggacctccttctgcatctctctctccctctctctctat ctctctctctctctctctctctctctctctctctacccatttcgctctgcacccctggaactccctctgcaactcttcca gtctccccacagaaaaatgaaaatccgcaccttgggttttttccttggtttgccgttgctttctgggttttgttttatat gtttgtttttgtttatgctgttagctccggaaatccaatgtttgtcacccgggaaaaaaactccaacgaaaatt | |||||
| User's notes | |||||
| Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 24 November 2005 - Time: 17:23 This markers has been mapped only on the alternative maps Calenge_TAG110_DT5==>CH05b06a and Calenge_TAG110_DT10==>Ch05b06b. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
172:174 164:174:220 138:160:174:226 154:164:174:220 164:174 140:164:174:214 164:222 |
||||
Send comments to Luca Gianfranceschi
