C6554
Primer features | |||||
Name | Sequence | Length | Tm | ||
C6554.F | TCAGAGCAATGGAATGTGGA | 20 nt | 56.4 °C | ![]() |
|
C6554.R | CGAGAGAAGAGGAACATCGAG | 21 nt | 61.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 290-310 | ||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | |||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 282 | ||||
Linkage group(s) | |||||
Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
Other maps | PI 613988-2 Royal Gala-2 | ||||
Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
Remarks | EST accessions in GenBank: DR996658, CN913108, DR991637, DR992262, DR995990, CN875834, CN907408, DR991724, CN497235, CX024728, CN913077, DR995796, EB151055, CN494350, CN994604, DR993381, CN875594, CN907163, CV655651, CX025079, CN579846, CO754916, CN945375 | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)