CH03d10
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03d10.F | CTCCCTTACCAAAAACACCAAA | 22 nt | 58.4 °C | ![]() |
|
CH03d10.R | GTGATTAAGAGAGTGATCGGGG | 22 nt | 62.1 °C | ||
SSR info | |||||
SSR repeat type | Compound | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 166-182 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.76 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 172 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Regia x Pingo-2 Regia x Piflora-2 Discovery-2 Fiesta-2 Fiesta x Totem-2 Royal Gala-2 Malling9-2 Robusta5-2 Apple Integrated Map-2 M.27 x M.116-2 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03d10 aattaccctctctctctctctctctctctctctctctctctctctctcccctcccccttccccttctctcccttaccaaa aacaccaaaacaactctctctctctctctctctctcccccctttcctttctctctctgtttaagttcttctctcatggtt tctcaataaaacccttatctttctccacactctcactctccgggtactgcaatcagaccccgatcactctcttaatcact cgctttacggtacgattttcggttaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
166:168 166:182 166:nul 170:172 172:182 172:182 172 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)