
CH01d07
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH01d07.F | AAAATCCAGTTTTCCACCTC | 20 nt | 54.3 °C | ||
| CH01d07.R | AGTCGAAATCCCGAACAATC | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | presumed single locus | ||||
| Detected loci | |||||
| Alleles size range | 102-106 | ||||
| Number of alleles detected | 3 | ||||
| Expected heterozygosity | 0.59 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 101 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta x Totem-4 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH01d07 aattccaaaaaatccagttttccacctctctctctctccctctctctcccccctgacaatcacaggtaaatacctatcta tgtatctccgattgttcgggatttcgactccgctcgtttctgttcttccaacgttgaaaatcctttanantctttataac ttcaaacttgttccttattccgtttcccacgttttctcagcaccaaaaggcaaaagctgtgatttttaggattgattcga tatctgtccatgttgtttgttatttgctatatgttagtgtttttgtatgcatggttttgttaacttggttcttctgtttg tatgtcgttgacaaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
102:104 104 102:104 106 102:104 104 104:106 |
||||



