
GD6
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| GD6.F | ATTTTGGAACACACACTCCCTCAGA | 25 nt | 64.1 °C | ||
| GD6.R | GACGCCATACCCATTGACGATT | 22 nt | 62.1 °C | ||
| SSR info | |||||
| SSR repeat type | |||||
| Locus type | SSR | ||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | |||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA | ||||
| Other maps | Fiesta x Totem-4 Malling9-4 Robusta5-4 Malling9-12 Robusta5-12 M.27 x M.116-4 M.27 x M.116-12 | ||||
| Reference publication | Hemmat M, Weeden NF, Brown SK (2003) Mapping and Evaluation of Malus �domestica Microsatellites in Apple and Pear. J. AMER. SOC. HORT. SCI. 128(4): 515�520 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||



