
C2811
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| C2811.F | CAGAATCCCCTCCTGTCAAA | 20 nt | 58.4 °C | ||
| C2811.R | TGACCGAAAAGGCAGAAACT | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 195-240 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 216 | ||||
| Linkage group(s) | |||||
| Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
| Other maps | Royal Gala-5 | ||||
| Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
| Remarks | EST accessions in GenBank: CN921946, CO541208 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||



