Hi04d10
Primer features | |||||
Name | Sequence | Length | Tm | ||
Hi04d10.F | AAATTCCCACTCCTCCCTGT | 20 nt | 58.4 °C | ![]() |
|
Hi04d10.R | GTTTGAGACGGATTGGGGTAG | 21 nt | 61.3 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 164-182 | ||||
Number of alleles detected | 4 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Fiesta-6 PI 613988-6 | ||||
Reference publication | Silfverberg-Dilworth E, Matasci C L, Van de Weg W E, Van Kaauwen M P W,Walser M, Kodde L P, Soglio V, Gianfranceschi L, Durel C E, Costa F, Yamamoto T, Koller B, Gessler C, Patocchi A (2006) Microsatellite markers spanning the apple (Malus x domestica Borkh) genome. Tree Genetics & Genomes 2(4): 202-224 | ||||
Remarks | extra bands | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
164 nul 182 164:182 180 164 182 164:180 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)