NZ23g4
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ23g4.F | TTTCTCTCTCTTTCCCAACTC | 21 nt | 57.4 °C | ||
NZ23g4.R | AGCCGCCTTGCATTAAATAC | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 84-116 | ||||
Number of alleles detected | 9 | ||||
Expected heterozygosity | 0.76 | ||||
PCR annealing temp | 50 | ||||
Sequenced allele size | 88 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Braeburn-7 Telamon-7 Fiesta-6 Prima-6 Discovery-6 Fiesta-6 Malling9-6 Robusta5-6 Apple Integrated Map-6 M.27 x M.116-6 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
n.d. 85/99 85/119 n.d. n.d. n.d. n.d. |
Send comments to Luca Gianfranceschi