CH04e05
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH04e05.F | AGGCTAACAGAAATGTGGTTTG | 22 nt | 58.4 °C |  |
|
| CH04e05.R | ATGGCTCCTATTGCCATCAT | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 174-227 | ||||
| Number of alleles detected | 8 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 200 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-7 Fiesta x Discovery-7 Prima x Fiesta-7 Braeburn-4 Telamon-4 Discovery-7 Fiesta-7 Fiesta x Totem-7 PI 613988-7 Malling9-7 Apple Integrated Map-7 M.27 x M.116-7 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH04e05 aattcagttgctgcctcggagggagagagagagagagagagagagtttaaacttggaaaagagaaggctaacagaaatgt ggtttgtgagaaataaagttcttgttctttaaataggagagatgtctgggcagaacccaggagacaaagggtgagccaca tggctatttttgtgtttgtatctgtncttganagagagaganagagagagagagagagagaganagagagggctttccnt antnatgatggcaataggagccatgattacaaaggccnattaaaatgattgaaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
174:181:209 199:227 197:201 174:181:201 181:201 181:203 174:181:203 |
||||
Send comments to Luca Gianfranceschi
