C10534
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| C10534.F | CATGCTGCATTCAAGGAAGA | 20 nt | 56.4 °C |  |
|
| C10534.R | CAATCCATTACACATGCGGT | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 330-375 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 251 | ||||
| Linkage group(s) | |||||
| Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
| Other maps | Royal Gala-9 | ||||
| Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
| Remarks | EST accessions in GenBank: CN912583, CN946427, CN913894, CV657789, CN946130, CN943459, CN948534, CN866644, CN948950, CN939262, CN939265, CN938814, CN947175, CN868428, CN866646, CN913024, CO903119, CN945812, CN945841, CN884483, CN861595 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
