
NZmsCN892357
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NZmsCN892357.F | AGGTGAAGGTGGCTCAAAGA | 20 nt | 58.4 °C | ||
| NZmsCN892357.R | AATTGTACGGCTCGGAACAG | 20 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | |||||
| Locus type | multi-locus | ||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | Horticulture and Food Research Institute of New Zealand | ||||
| Other maps | Malling9-9 M.27 x M.116-3 M.27 x M.116-11 | ||||
| Reference publication | Celton JM,Tustin DS, Chagn� D, Gardiner SE (2008) Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus�genomic sequences. Tree Genetics & Genomes 5(): 93-107 | ||||
| Remarks | ?Royal Gala? | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||



