C13280
Primer features | |||||
Name | Sequence | Length | Tm | ||
C13280.F | CCTTCACTCACCTTTCTCGC | 20 nt | 60.5 °C | ![]() |
|
C13280.R | CTCCTCCTCCCTCAGTACCC | 20 nt | 64.6 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 250-300 | ||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | |||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 294 | ||||
Linkage group(s) | |||||
Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
Other maps | PI 613988-1 | ||||
Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
Remarks | EST accessions in GenBank: CO753391, CV629518, CN893235, CO066296, DT002426, CO419052, CN579917, CO415768, CO752675, CO754003, CN496019, CV657248, EB155492, CV630941, CO417949, CO052074, EB155754, CO067999 | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)