C13280
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| C13280.F | CCTTCACTCACCTTTCTCGC | 20 nt | 60.5 °C |  |
|
| C13280.R | CTCCTCCTCCCTCAGTACCC | 20 nt | 64.6 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 250-300 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 294 | ||||
| Linkage group(s) | |||||
| Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
| Other maps | PI 613988-1 | ||||
| Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
| Remarks | EST accessions in GenBank: CO753391, CV629518, CN893235, CO066296, DT002426, CO419052, CN579917, CO415768, CO752675, CO754003, CN496019, CV657248, EB155492, CV630941, CO417949, CO052074, EB155754, CO067999 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
