C19758
Primer features | |||||
Name | Sequence | Length | Tm | ||
C19758.F | CCAACCGCCAAAACTAGAAA | 20 nt | 56.4 °C | ![]() |
|
C19758.R | GGCGGCCATACAGTAAAAGA | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 265-290 | ||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | |||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 276 | ||||
Linkage group(s) | |||||
Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
Other maps | Royal Gala-1 | ||||
Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
Remarks | EST accessions in GenBank: CN875951, DT041165, CV629546, CN876144, DR993766, CV630897 | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |

