C482
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| C482.F | CCTCTACACCTACCCCCTCC | 20 nt | 64.6 °C |  |
|
| C482.R | CTTGAATTGGAAACATGGGG | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 200-250 | ||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 212 | ||||
| Linkage group(s) | |||||
| Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
| Other maps | PI 613988-17 Royal Gala-17 | ||||
| Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
| Remarks | EST accessions in GenBank: CN894368, CN862397, CV467138, CV466514, CN996311, CN906584, CN492891, CV129780, CV128918, CN901513, CV466015, CN899856, CN903263 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
