C9289
Primer features | |||||
Name | Sequence | Length | Tm | ||
C9289.F | AACATCCAAACAACCACACG | 20 nt | 56.4 °C | ||
C9289.R | GAGCCTTTTTATTTGCAGCG | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 110-130 | ||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | |||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 131 | ||||
Linkage group(s) | |||||
Developed by | Dept. Horticulture, Cornell Univ. NY | ||||
Other maps | Royal Gala-6 | ||||
Reference publication | Wang A, Aldwinckle H, Forsline P, Main D, Fazio G, Brown S, Xu K (2012) EST contig-based SSR linkage maps for Malus x domestica cv Royal Gala and an apple scab resistant accession of M. sieversii, the progenitor species of domestic apple. Molecular Breeding 29(2): 379-397 | ||||
Remarks | EST accessions in GenBank: CN851135, CN849583, CN851265, CN849001, CN945295, CN914941, CN895730, CN852025, CN850871, CN849082, CN851406, CN850312, CN851249, CN851756, CN850932, CN851374, CN851328 | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
Send comments to Luca Gianfranceschi