CH01b09b
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01b09b.F | TTATAGCAGCAACAGGAGCG | 20 nt | 58.4 °C | ![]() |
|
CH01b09b.R | TATTCGGGAGGCATGGTATG | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Compound | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 172-182 | ||||
Number of alleles detected | 4 | ||||
Expected heterozygosity | 0.66 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 182 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | |||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01b09b aatttgcggttcaggcatcntgatgaatgttttcatgttatcaggacttataaaatatcgatttcgtgttttagaagaat gtggattagatggaagctatgaaaaagcctttgaatgtnagttgtagaagatcactctccaaaatcctttagttccttat agcagcaacaggagcgtggcctattttcctgagggtaaagagaangagagggtcgacgggagagagagaganagagagag agagagagtgtgtcntgccccgatctcnacatacatccanaatcnacacgtgacgctaccaaataccctaatatataaca taccatgcctcccgaatatatacaaantatcaatcanaaactanatgcncaataatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
172:182 172:172 176:182 172 176:182 182 172:182 |

