
CH01c06
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH01c06.F | TTCCCCATCATCGATCTCTC | 20 nt | 58.4 °C | ||
| CH01c06.R | AAACTGAAGCCATGAGGGC | 19 nt | 57.3 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 146-188 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | 0.73 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 184 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta-8 Discovery x TN10-8-8 Discovery-8 Fiesta-8 Fiesta x Totem-8 Northern Spy-8 Discovery-8 PI 613988-8 Malling9-8 Robusta5-2 Apple Integrated Map-8 M.27 x M.116-8 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH01c06 aattcacatgaggctgatgatctgctgctccaacactaaaaacaaacaatcccattactaacaagagcaatatactcctc cttttccccatcatcgatctctccgcttctcactcacaatcttgcacagagagagagagagagagagagagagagagaga gagagagagagagagagagagagagaggaatgtgtctggtttaagaggaggaagataagaatgtcttgattatataccgt gcgtgcatgccctcatggcttcagttttagtccacgtgtcgaatgagcaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
156:160 160:170 160:172 172:188 160:188 160:188 146:160 |
||||



