CH01c08
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01c08.F | TCACTGTCCTTATCTTTCACCAC | 23 nt | 61.1 °C | ![]() |
|
CH01c08.R | GCAGAAAAAGCACCCACC | 18 nt | 56.1 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 130-228 | ||||
Number of alleles detected | 5 | ||||
Expected heterozygosity | 0.71 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 225 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | |||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01c08 aatttcgtctcttgtccgggcgaccacaccctaccattctcctcgtatcgcccttgttgtcattaaaatggctctcactc atatatatactcactgtccttatctttcaccactctttctgtcactctcgctctcgctgcatctttacctctctctctct ctctctctctctctctctctctctctctctctctctcnttatctttcaccactctgtctgtcactctcgctctcactgca tctttacctctctctctctctntctctctctctcanatggnatcatcatcgttnnctggtgggtgctttttctgcntggg cngganggaggatttca | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
132 130 130:218 n.d. 130:228 130:216 132:228 |

