CH01f02
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH01f02.F | ACCACATTAGAGCAGTTGAGG | 21 nt | 59.4 °C |  |
|
| CH01f02.R | CTGGTTTGTTTTCCTCCAGC | 20 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 174-206 | ||||
| Number of alleles detected | 7 | ||||
| Expected heterozygosity | 0.79 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 185 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-12 Fiesta x Discovery-12 Braeburn-10 Telamon-10 Discovery-12 Fiesta-12 Fiesta x Totem-12 Robusta5-12 Apple Integrated Map-12 M.27 x M.116-12 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH01f02 tacatccaaatcttcaaccacattagagcagttgaggatgattaagtcactaaaccaaacatcctttatagtagaacaca gagagagagagagagagagagagagagagagagagagagagagtacatatttcacagagaaactaaaganggtgcataca tgtgagtactatgtttggggggctggaggaaaacaaaccagctgtgtccacaaccatctgctgctaccctatttccttcc tatattatctgcaaaacatgatacacaanggtcacacaaataaaactattagagcaacattgatcaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
180:206 182:204 184:206 180:206 184:206 180:206 180:184 |
||||
Send comments to Luca Gianfranceschi
