CH01f02
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01f02.F | ACCACATTAGAGCAGTTGAGG | 21 nt | 59.4 °C | ![]() |
|
CH01f02.R | CTGGTTTGTTTTCCTCCAGC | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 174-206 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | 0.79 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 185 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-12 Fiesta x Discovery-12 Braeburn-10 Telamon-10 Discovery-12 Fiesta-12 Fiesta x Totem-12 Robusta5-12 Apple Integrated Map-12 M.27 x M.116-12 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01f02 tacatccaaatcttcaaccacattagagcagttgaggatgattaagtcactaaaccaaacatcctttatagtagaacaca gagagagagagagagagagagagagagagagagagagagagagtacatatttcacagagaaactaaaganggtgcataca tgtgagtactatgtttggggggctggaggaaaacaaaccagctgtgtccacaaccatctgctgctaccctatttccttcc tatattatctgcaaaacatgatacacaanggtcacacaaataaaactattagagcaacattgatcaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
180:206 182:204 184:206 180:206 184:206 180:206 180:184 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)