CH01f09
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH01f09.F | ATGTACATCAAAGTGTGGATTG | 22 nt | 56.5 °C |  |
|
| CH01f09.R | GGCGCTTTCCAACACATC | 18 nt | 56.1 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 125-160 | ||||
| Number of alleles detected | 7 | ||||
| Expected heterozygosity | 0.77 | ||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 136 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta-8 Prima-8 Discovery-8 Fiesta-8 Fiesta x Totem-8 M.27 x M.116-8 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | <font size=-2><b>Reverse primer modified, old primer didn't work</b></font> | ||||
| Sequence | |||||
| >CH01f09 ncntatncngtctnccgaacggactgaccgtctggcatatggcatgtacatcaaagtgtggattgatgcagaaaactcag agataaaaaaagtcctagagagagagagagagagagagagagagagagagagagagagaggacngtcggtgagacagagt tgatgtgttggaaagcgcccaaacaaaccngtaccgcnagaaaaatcngcngtaaacgagagagagagagagagagagag agagagagatatgatgttgnatacaaatacagttcctccntcctgttctgaaatt | |||||
| User's notes | |||||
| Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:06 The Reverse primer has been modified since the old one did not work. The reported primer is the correct one. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
135:160 125:141 131:141 131:137 135:141 139:141 131:141 |
||||
Send comments to Luca Gianfranceschi
