CH01f09
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01f09.F | ATGTACATCAAAGTGTGGATTG | 22 nt | 56.5 °C | ![]() |
|
CH01f09.R | GGCGCTTTCCAACACATC | 18 nt | 56.1 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 125-160 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | 0.77 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 136 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta-8 Prima-8 Discovery-8 Fiesta-8 Fiesta x Totem-8 M.27 x M.116-8 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | <font size=-2><b>Reverse primer modified, old primer didn't work</b></font> | ||||
Sequence | |||||
>CH01f09 ncntatncngtctnccgaacggactgaccgtctggcatatggcatgtacatcaaagtgtggattgatgcagaaaactcag agataaaaaaagtcctagagagagagagagagagagagagagagagagagagagagagaggacngtcggtgagacagagt tgatgtgttggaaagcgcccaaacaaaccngtaccgcnagaaaaatcngcngtaaacgagagagagagagagagagagag agagagagatatgatgttgnatacaaatacagttcctccntcctgttctgaaatt | |||||
User's notes | |||||
Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:06 The Reverse primer has been modified since the old one did not work. The reported primer is the correct one. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
135:160 125:141 131:141 131:137 135:141 139:141 131:141 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)