CH01f12
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH01f12.F | CTCCTCCAAGCTTCAACCAC | 20 nt | 60.5 °C |  |
|
| CH01f12.R | GCAAAAACCACAGGCATAAC | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 145-162 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | 0.8 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 151 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta-10 Discovery-10 Fiesta-10 Apple Integrated Map-10 M.27 x M.116-10 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH01f12 aattgtgggctttacctgtactgagatcaccagtagttgctggtgtcgggtttctaactggagaaccccaacaaatcccc atcttcttcttccttttcctcttcctcttggattctacctcctccaagcttcaaccactaaaagggtgctctctcccccc tctcctctatctctctctctctctctctctctctctctctctctctctccagtattccagaaaatgatgaacaaaagggc tctgactttgttatgcctgtggtttttgcganccaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
145:162 154:156 152:156 154:162 150:154 154:162 150:162 |
||||
Send comments to Luca Gianfranceschi
