CH01f12
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01f12.F | CTCCTCCAAGCTTCAACCAC | 20 nt | 60.5 °C | ||
CH01f12.R | GCAAAAACCACAGGCATAAC | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 145-162 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.8 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 151 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta-10 Discovery-10 Fiesta-10 Apple Integrated Map-10 M.27 x M.116-10 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01f12 aattgtgggctttacctgtactgagatcaccagtagttgctggtgtcgggtttctaactggagaaccccaacaaatcccc atcttcttcttccttttcctcttcctcttggattctacctcctccaagcttcaaccactaaaagggtgctctctcccccc tctcctctatctctctctctctctctctctctctctctctctctctctccagtattccagaaaatgatgaacaaaagggc tctgactttgttatgcctgtggtttttgcganccaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
145:162 154:156 152:156 154:162 150:154 154:162 150:162 |
Send comments to Luca Gianfranceschi