CH02a08
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02a08.F | GAGGAGCTGAAGCAGCAGAG | 20 nt | 62.5 °C | ![]() |
|
CH02a08.R | ATGCCAACAAAAGCATAGCC | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 133-177 | ||||
Number of alleles detected | 15 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 152 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-10 Discovery-5 Fiesta-10 Discovery x TN10-8-10 Discovery-5 Discovery-10 Fiesta-5 Fiesta-10 Fiesta x Totem-10 Malling9-10 Apple Integrated Map-5 Apple Integrated Map-10 M.27 x M.116-5 M.27 x M.116-10 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02a08a aattatggagaagatgcaacttgggggaccctcaatgcgcttgttagaggtgtgcttatttacaagatgtacaaactaga gtcatgtaactatcttataaacatcatcttgatgtgtttaatatgtcctgcagctgctggaggagctgaagcagcagagc tctggcggcgaactccatctcaatgatgttagtatattgctctctctctctctctctctctctctctctctctctctctc tctcaatacaaacacagattggcatgctgatggctatgcttttgttggcatttcanctgaggactgcaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
139:147:151:173 145:155:165:177 139:143:151:173 153:165:167 137:147:151 137:139:147:151 137:139:151:159 |

