CH02b03b
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02b03b.F | ATAAGGATACAAAAACCCTACACAG | 25 nt | 60.9 °C | ||
CH02b03b.R | GACATGTTTGGTTGAAAACTTG | 22 nt | 56.5 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 77-109 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.8 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 101 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-10 Discovery-10 Fiesta-10 Fiesta-10 Mondial Gala-10 Fiesta x Totem-10 PI 613988-10 Royal Gala-10 Malling9-10 Robusta5-10 Apple Integrated Map-10 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02b03b aatttgtataaggatacaaaaaccctacacagtttctcaaccctctctctctctctctctctctctctctctctctctct ctctctcaagttttcaaccaaacatgtcttgatncaaactctacactggcttcctcttcttcttcttctcttntgggtat | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
93:97 77:97 97:99 81:101 97:101 93:95 101:109 |
Send comments to Luca Gianfranceschi