CH02b03b
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH02b03b.F | ATAAGGATACAAAAACCCTACACAG | 25 nt | 60.9 °C |  |
|
| CH02b03b.R | GACATGTTTGGTTGAAAACTTG | 22 nt | 56.5 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 77-109 | ||||
| Number of alleles detected | 8 | ||||
| Expected heterozygosity | 0.8 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 101 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-10 Discovery-10 Fiesta-10 Fiesta-10 Mondial Gala-10 Fiesta x Totem-10 PI 613988-10 Royal Gala-10 Malling9-10 Robusta5-10 Apple Integrated Map-10 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH02b03b aatttgtataaggatacaaaaaccctacacagtttctcaaccctctctctctctctctctctctctctctctctctctct ctctctcaagttttcaaccaaacatgtcttgatncaaactctacactggcttcctcttcttcttcttctcttntgggtat | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
93:97 77:97 97:99 81:101 97:101 93:95 101:109 |
||||
Send comments to Luca Gianfranceschi
