CH02b11
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02b11.F | ACCTTACCTGGTAGAGAGAGA | 21 nt | 59.4 °C | ![]() |
|
CH02b11.R | CACAACGCAGTTCGATCACT | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | presumed single locus | ||||
Detected loci | |||||
Alleles size range | 114-158 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | 0.84 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 102 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-7 M.27 x M.116-7 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02b11 aattaccttacctggtagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagag agaggaagtgatcgaactgcgttgtgttccgccaaacggattgtttgtggtgttgtcactccccttcacttcgcctagtt gtttttgtgtcctagagagagagggcacttttcgatagggtgtacatggtttggtctagtgtgatttgtagtaatattct tttaagttagaggttttagattcgattctcgtcaaaggcgaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
116:122 114:158 116:118 116:156 156:158 118:122 114:156 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)