CH02c02b
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02c02b.F | TGCATGCATGGAAACGAC | 18 nt | 53.8 °C | ![]() |
|
CH02c02b.R | TGGAAAAAGTCACACTGCTCC | 21 nt | 59.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 78-126 | ||||
Number of alleles detected | 5 | ||||
Expected heterozygosity | 0.7 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 113 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-4 Fiesta-4 PI 613988-4 Royal Gala-4 Apple Integrated Map-4 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02c02b tagggtttgcatgcatggaaacgacgggtcattttccaactgtgctcgccgttgctgtgtggagatgtcgggggtagaga gagagagagagagagttctggagcagtgtgactttttccaaatatcattcatacaaaatgttggattaaaaccagagaat atttctttgatacaaatgacatcggaagggaaatcgaacacaaaatctcgggtggagggggaatgctctgatctacttga gccaccagccccttgcaccctgtaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
112:116 112:116 78:126 78:122 112:116 112:116 112:116 |

