
CH02d11
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH02d11.F | AGCGTCCAGAGCAACAGC | 18 nt | 58.4 °C | ||
| CH02d11.R | AACAAAAGCAGATCCGTTGC | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 118-148 | ||||
| Number of alleles detected | 7 | ||||
| Expected heterozygosity | 0.73 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 133 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-15 Fiesta-15 Prima-15 Fiesta-15 Fiesta x Totem-15 PI 613988-15 Royal Gala-15 Apple Integrated Map-15 M.27 x M.116-15 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH02d11 aattcggttggagctgcatgaagaaaatggagttggtggtggtccaaacaccccaccttc tttttggtgcttagagtttttggcaagtgtttgagattcgagcagagtcgtctctctctt tctgtcatcaaacgccgagcccaagcagcatcaaaataagcgtccagagcaacagccaag tttagagagagagagatatanagagagagagagagagagagagagcgagagctcatgaat atgcaataaaaataaaatgtgcctttgatctgcaacggatctgcttttgttttctgtttg tgagattttgtcccccttcctttcccttccacttgcaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ![]() | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
118:132 120:132 120:132 122:126 132 122:132 132:144 |
||||




