CH02g01
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH02g01.F | GATGACGTCGGCAGGTAAAG | 20 nt | 60.5 °C |  |
|
| CH02g01.R | CAACCAACAGCTCTGCAATC | 20 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | presumed single locus | ||||
| Detected loci | |||||
| Alleles size range | 198-238 | ||||
| Number of alleles detected | 5 | ||||
| Expected heterozygosity | 0.7 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 216 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta x Totem-13 PI 613988-13 Apple Integrated Map-13 M.27 x M.116-13 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH02g01 aattatgtggatgacgtcggcaggtaaagtttcagactttaatggtagattgcagtctctctctctctctctctctctct ctctctctctctctctctctctcaaatgtatgtttgcattgtgcagtgaatgggatcagcctcctagtgaaatgagacca gctggttcagtttccatcanggtgcgtatttgggttcttaagtttgattgcagagctgttggttggcatgagtttaatgt acgtgtggatttncaggactatgcaatagagacacccttgaaggaatcgttgtcgccggtgggaggcgatacatctcacg aagtgaagattgatgttacacccaacagcgcaatcgcagcgataaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
226:238 226:226 198:218 218:226 218 218:238 218:226 |
||||
Send comments to Luca Gianfranceschi
